Advertisement
Science

DNA Tribes and Ethnoancestry: Establishing your Origin through Genetic Analysis

Want to know, based on genetic evidence, where you come from? Do you suspect you may have an European ancestry, or do you have some American native background? Learn about DNA Tribes and Ethnoancestry, two biotech companies that can help you get ancestry information based on your DNA analysis

By Rafael
Desk Science
Reading time 3 min read
Word count 590
Genetics Science Genetic testing
DNA Tribes and Ethnoancestry: Establishing your Origin through Genetic Analysis
Advertisement
Quick Take

Want to know, based on genetic evidence, where you come from? Do you suspect you may have an European ancestry, or do you have some American native background? Learn about DNA Tribes and Ethnoancestry, two biotech companies that can help you get ancestry information based on your DNA analysis

On this page

In the past, genetic tests were used by scientists in complex research protocols. Today, genetic testing has permeated the mainstream and is being used more frequently for a variety of purposes. With the advent of cheaper and faster DNA sequence technologies, the possibility of knowing the genome of any person is becoming a reality.

One way that has popularized genetic testing is to learn or investigate where a person comes from: his ethnic origin or background. There a few biotechnological companies that are focusing their businesses on telling people where they come from, genetically speaking, based on information obtained from a person’s genomic analysis

Advertisement

DNA Tribes

One of the most popular companies that analyze the personal ethnic background of people is the US-based company DNA tribes

(www.dnatribes.com ). DNA Tribes performs what they call “Genetic Ancestry Analysis.” This is a service in which they promise to deliver your ethnic background based on the analysis of the information obtained from a genetic analysis made on a sample you sent them. After ordering the service, you receive a cheek swab. After taking your own sample, you return it for analysis. Results are sent to you by electronic mail. A lot of statistics and bioinformatics are involved in analyzing your DNA results, since your genetic pattern is compared to 21 populations (called tribes) from around the world, including indigenous populations.

Advertisement

DNA Tribes uses autosomal STR genetic markers developed by the FBI for individual identification. STR stands for Small Tandem Repeats. A STR is a pattern of two (or more) nucleotides, which are repeated in the DNA and are directly adjacent to each other. For example, the GATA short sequence could be repeated 5 times as GATAGATAGATAGATAGATA and would constitute a STR that would be unique to a particular person. By having many of those STRs, a unique profile is created for that person. By comparing these unique STRs with that of worldwide known populations, it is possible to estimate the ethnical origin of a person.

Ethnoancestry

Ethnoancestry (www.ethnoancestry.com ) defines itself as an “innovative genetic genealogy company,” meaning a genealogy company that uses genetic analysis to establish connections of a person to her past. This company operation is based in London. After receiving a DNA extraction kit by mail, you give a saliva sample and mail it back to the company. They have a variety of services you can perform: paternal ancestry, maternal ancestry, deep ancestry interpretation, Oppenheimer test, etc.

Advertisement

Ethnoancestry is tailored to Europe and strives for people to know their connection to European populations. Deep ancestry is tailored to people willing to dig more into their pasts and to know exactly where they came from. They do that by investigating specific SNP genotypes. SNP stands for single nucleotide polymorphisms. SNPs are genetic markers that are inherited by certain population groups. If you have a particular SNP, there is a high probability that you come from that group.

Genetic Ancestry Analysis or Genetic Genealogy: Is this for real?

DNA tribes and Ethnoancestry exemplify the new companies that are trying to get a profit from the genetic revolution and from the dissemination of genetic information to society. If you look into opinions about their services you will find everything from the highly satisfied customer to the very angry one. Some people even think that these companies are elaborate scams. The truth is that genetic information is a powerful tool for knowing a person’s origin. Perhaps more time and research is needed to see if these services can be trusted.

Advertisement

Sources

https://www.nytimes.com/2006/04/12/us/12genes.html?pagewanted=1&_r=1&sq=DNA%20Tribes&st=cse&scp=1 .

https://www.cstl.nist.gov/biotech/strbase/

Advertisement
Keep Exploring

More from Science

How Reading Rewires Your Brain

How Reading Rewires Your Brain

Confucius said, “Without knowing the force of words, it is impossible to know men.” The largest part of your brain is …

Second-Hand Smoke Issues

Second-Hand Smoke Issues

What is Secondhand Smoke? Secondhand smoke consists of the plume of chemicals and burning agents that come off the tip …

Filed under
Genetics Science
More topics
Genetic testing
Advertisement